Virus:Article Title: Tumor mitochondrial oxidative phosphorylation stimulated by the nuclear receptor RORγ represents an effective therapeutic opportunity in osteosarcoma.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rat monoclonal anti-RORg Thermo Fisher Scientific Cat#14-6988-82; RRID:AB_1834475 Rabbit monoclonal anti-GAPDH Cell Signaling Technology Ca#2118; RRID:AB_561053 Rabbit polyclonal anti-PARP Cell Signaling Technology Cat#9542; RRID:AB_2160739 Rabbit polyclonal anti-cleaved-Caspase-3 Cell Signaling Technology Cat#9661; RRID:AB_2341188 Rabbit monoclonal anti-AMPKa Cell Signaling Technology Cat#5832; RRID:AB_10624867 Rabbit monoclonal anti-p-AMPKa1 (Ser485) Cell Signaling Technology Cat#2537; RRID:AB_659805 Rabbit monoclonal anti-mTOR Cell Signaling Technology Cat#2983; RRID:AB_2105622 Rabbit monoclonal anti-p-mTOR(Ser2448) Cell Signaling Technology Cat#5536; RRID:AB_10691552 Rabbit monoclonal anti-Cystatin C Cell Signaling Technology Cat#24840; RRID:AB_2798885 Rabbit monoclonal anti-PGC-1b Abcam Cat#ab176328; RRID:AB_2893194 Mouse monoclonal anti-OXPHOS Abcam Cat#ab110411; RRID:AB_2756818 Goat polyclonal anti-GPX4 Abcam Cat#ab116703; RRID:AB_10898676 Rabbit polyclonal anti-4-HNE Abcam Cat#ab46545; RRID:AB_722490 Rabbit polyclonal anti-VDAC1 Abcam Cat#ab15895; RRID:AB_2214787 Rabbit monoclonal anti-ACC1 Beyotime Biotechnology Cat#AF1867; RRID:AB_3096398 Rabbit polyclonal anti-p-ACC(Ser79) Beyotime Biotechnology Cat#AA110; RRID:AB_3096395 Mouse monoclonal anti-Bcl-xL Santa Cruz Cat#sc-136207; RRID:AB_2064727 Rabbit polyclonal anti-SLC7A11 ABclonal Cat#A13685; RRID:AB_2760546 Anti-mouse IgG, HRP-linked Antibody Cell Signaling Technology Cat#7076; RRID:AB_330924 Anti-rat IgG, HRP-linked Antibody Cell Signaling Technology Cat#7077; RRID:AB_10694715 Anti-rabbit IgG, HRP-linked Antibody Cell Signaling Technology Cat#7074; RRID:AB_2099233 Bacterial and virus strains DH5a TSINGKE Cat#TSC-C14 Biological samples Osteosarcoma patient-derived xenografts (PDX) the First Affiliated Hospital, Sun Yat-sen University N/A Chemicals, peptides, and recombinant proteins Z-VAD-FMK TargetMol Cat#T7020 XY018 WuXi App Tec N/A GSK805 WuXi App Tec N/A Paclitaxel Selleck Cat#S1150 Antimycin A TargetMol Cat# T37497 Rotenone Selleck Cat#S2348 N-acetyl-L-cysteine Beyotime Biotechnology Cat#S0077 Methotrexate Acmec Biochemical Cat#M64330 IACS-010759 TargetMol Cat#T5337 Erastin, TargetMol Cat#T1765 Ferrostatin-1 TargetMol Cat#T6500 Critical commercial assays NAD+/NADH ratio Assay Kit Beyotime Biotechnology Cat#S0175 Lipid oxidation (MDA) Assay Kit Beyotime Biotechnology Cat#S0131S Cell-Titer GLO Promega Cat#G9241 Caspase GLO 3/7 Promega Cat#G8090 (Continued on next page) e1 Cell Reports Medicine 5, 101519, May 21, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Luciferase reporter gene Assay Kit Beyotime Biotechnology Cat#RG028 Reactive oxygen species Assay Kit Beyotime Biotechnology Cat#S0033S FerroOrange Assay Kit DOJINDO LABORATORIES Cat#F374 BODIPYTM 581/591 C11 (Lipid Peroxidation Sensor) Thermo Fisher Scientific Cat#D3861 Cell Mito Stress Test Kit Agilent Technologies Cat#103015-100 Glycolysis Stress Test Kit Agilent Technologies Cat#103020-100 Deposited data Raw and analyzed data Gene Expression Omnibus GEO: GSE99671, GSE39055, GSE126380, GSE28974, GSE33382 scRNA-seq data Gene Expression Omnibus GEO: GSE152048 and GSE162454 RNA-seq data This paper GSE261067 Western blot original images in this paper Mendeley Dataset https://doi.org/10.17632/yzygjpm6k5.1 Experimental models: Cell lines U2OS cell line ATCC HTB-96 MG63 cell line ATCC CRL-1427 143B cell line ATCC CRL-8303 SJSA-1 cell line ATCC CRL-2098 MNNG/HOS cell line ATCC CRL-1547 HEK293T cell line ATCC CRL-11268 143B-Luci cell line This paper N/A U2OS-MTX-R cell line This paper N/A hMSCs cell line Cyagen Biosciences HUXMA-01001 Experimental models: Organisms/strains Nude mice Nanjing Biomedical Research Institute of Nanjing University N/A NOD/SCID mice Nanjing Biomedical Research Institute of Nanjing University N/A Oligonucleotides siRNA targeting sequence This paper See Table S1 qRT-PCR Primer sequence This paper See Table S2 shRORg targeting sequence This paper GCCCTCATATTCCAACAACTT ChIP-PCR Primer sequence This paper See Table S3 Recombinant DNA Plasmids pBD-RORg-LBD This paper N/A Plasmids PBD-ERRa-LBD This paper N/A Plasmids PCMV-PPARg-LBD This paper N/A Plasmids pFR-luci This paper N/A Plasmids pcDNA-PGC-1b This paper N/A Plasmids PLX-304- RORg This paper N/A Software and algorithms ImageJ ImageJ https://imagej.nih.gov/ij/ GraphPad Prism7 GraphPad https://www.graphpad.com Flow Jo 7.6 Flow Jo https://www.flowjo.com R version 4.2.0 R Core Team 2017 https://www.r-project.org RStudio ( 2023.12.1–402) Posit.co https://posit.co/download/rstudio-desktop/ ggplot2 (v3.5.5) N/A https://ggplot2-book.org/ GSVA package v1.40.1 N/A http://www.sagebase.org Gene set enrichment analysis (GSEA) Broad Institute http://www.broad.mit.edu/gsea/ Cell Reports Medicine 5, 101519, May 21, 2024 e2 OPEN ACCESS OPEN ACCESS
Recombinant:Article Title: Tumor mitochondrial oxidative phosphorylation stimulated by the nuclear receptor RORγ represents an effective therapeutic opportunity in osteosarcoma.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rat monoclonal anti-RORg Thermo Fisher Scientific Cat#14-6988-82; RRID:AB_1834475 Rabbit monoclonal anti-GAPDH Cell Signaling Technology Ca#2118; RRID:AB_561053 Rabbit polyclonal anti-PARP Cell Signaling Technology Cat#9542; RRID:AB_2160739 Rabbit polyclonal anti-cleaved-Caspase-3 Cell Signaling Technology Cat#9661; RRID:AB_2341188 Rabbit monoclonal anti-AMPKa Cell Signaling Technology Cat#5832; RRID:AB_10624867 Rabbit monoclonal anti-p-AMPKa1 (Ser485) Cell Signaling Technology Cat#2537; RRID:AB_659805 Rabbit monoclonal anti-mTOR Cell Signaling Technology Cat#2983; RRID:AB_2105622 Rabbit monoclonal anti-p-mTOR(Ser2448) Cell Signaling Technology Cat#5536; RRID:AB_10691552 Rabbit monoclonal anti-Cystatin C Cell Signaling Technology Cat#24840; RRID:AB_2798885 Rabbit monoclonal anti-PGC-1b Abcam Cat#ab176328; RRID:AB_2893194 Mouse monoclonal anti-OXPHOS Abcam Cat#ab110411; RRID:AB_2756818 Goat polyclonal anti-GPX4 Abcam Cat#ab116703; RRID:AB_10898676 Rabbit polyclonal anti-4-HNE Abcam Cat#ab46545; RRID:AB_722490 Rabbit polyclonal anti-VDAC1 Abcam Cat#ab15895; RRID:AB_2214787 Rabbit monoclonal anti-ACC1 Beyotime Biotechnology Cat#AF1867; RRID:AB_3096398 Rabbit polyclonal anti-p-ACC(Ser79) Beyotime Biotechnology Cat#AA110; RRID:AB_3096395 Mouse monoclonal anti-Bcl-xL Santa Cruz Cat#sc-136207; RRID:AB_2064727 Rabbit polyclonal anti-SLC7A11 ABclonal Cat#A13685; RRID:AB_2760546 Anti-mouse IgG, HRP-linked Antibody Cell Signaling Technology Cat#7076; RRID:AB_330924 Anti-rat IgG, HRP-linked Antibody Cell Signaling Technology Cat#7077; RRID:AB_10694715 Anti-rabbit IgG, HRP-linked Antibody Cell Signaling Technology Cat#7074; RRID:AB_2099233 Bacterial and virus strains DH5a TSINGKE Cat#TSC-C14 Biological samples Osteosarcoma patient-derived xenografts (PDX) the First Affiliated Hospital, Sun Yat-sen University N/A Chemicals, peptides, and recombinant proteins Z-VAD-FMK TargetMol Cat#T7020 XY018 WuXi App Tec N/A GSK805 WuXi App Tec N/A Paclitaxel Selleck Cat#S1150 Antimycin A TargetMol Cat# T37497 Rotenone Selleck Cat#S2348 N-acetyl-L-cysteine Beyotime Biotechnology Cat#S0077 Methotrexate Acmec Biochemical Cat#M64330 IACS-010759 TargetMol Cat#T5337 Erastin, TargetMol Cat#T1765 Ferrostatin-1 TargetMol Cat#T6500 Critical commercial assays NAD+/NADH ratio Assay Kit Beyotime Biotechnology Cat#S0175 Lipid oxidation (MDA) Assay Kit Beyotime Biotechnology Cat#S0131S Cell-Titer GLO Promega Cat#G9241 Caspase GLO 3/7 Promega Cat#G8090 (Continued on next page) e1 Cell Reports Medicine 5, 101519, May 21, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Luciferase reporter gene Assay Kit Beyotime Biotechnology Cat#RG028 Reactive oxygen species Assay Kit Beyotime Biotechnology Cat#S0033S FerroOrange Assay Kit DOJINDO LABORATORIES Cat#F374 BODIPYTM 581/591 C11 (Lipid Peroxidation Sensor) Thermo Fisher Scientific Cat#D3861 Cell Mito Stress Test Kit Agilent Technologies Cat#103015-100 Glycolysis Stress Test Kit Agilent Technologies Cat#103020-100 Deposited data Raw and analyzed data Gene Expression Omnibus GEO: GSE99671, GSE39055, GSE126380, GSE28974, GSE33382 scRNA-seq data Gene Expression Omnibus GEO: GSE152048 and GSE162454 RNA-seq data This paper GSE261067 Western blot original images in this paper Mendeley Dataset https://doi.org/10.17632/yzygjpm6k5.1 Experimental models: Cell lines U2OS cell line ATCC HTB-96 MG63 cell line ATCC CRL-1427 143B cell line ATCC CRL-8303 SJSA-1 cell line ATCC CRL-2098 MNNG/HOS cell line ATCC CRL-1547 HEK293T cell line ATCC CRL-11268 143B-Luci cell line This paper N/A U2OS-MTX-R cell line This paper N/A hMSCs cell line Cyagen Biosciences HUXMA-01001 Experimental models: Organisms/strains Nude mice Nanjing Biomedical Research Institute of Nanjing University N/A NOD/SCID mice Nanjing Biomedical Research Institute of Nanjing University N/A Oligonucleotides siRNA targeting sequence This paper See Table S1 qRT-PCR Primer sequence This paper See Table S2 shRORg targeting sequence This paper GCCCTCATATTCCAACAACTT ChIP-PCR Primer sequence This paper See Table S3 Recombinant DNA Plasmids pBD-RORg-LBD This paper N/A Plasmids PBD-ERRa-LBD This paper N/A Plasmids PCMV-PPARg-LBD This paper N/A Plasmids pFR-luci This paper N/A Plasmids pcDNA-PGC-1b This paper N/A Plasmids PLX-304- RORg This paper N/A Software and algorithms ImageJ ImageJ https://imagej.nih.gov/ij/ GraphPad Prism7 GraphPad https://www.graphpad.com Flow Jo 7.6 Flow Jo https://www.flowjo.com R version 4.2.0 R Core Team 2017 https://www.r-project.org RStudio ( 2023.12.1–402) Posit.co https://posit.co/download/rstudio-desktop/ ggplot2 (v3.5.5) N/A https://ggplot2-book.org/ GSVA package v1.40.1 N/A http://www.sagebase.org Gene set enrichment analysis (GSEA) Broad Institute http://www.broad.mit.edu/gsea/ Cell Reports Medicine 5, 101519, May 21, 2024 e2 OPEN ACCESS OPEN ACCESS
Multiple Displacement Amplification:Article Title: Tumor mitochondrial oxidative phosphorylation stimulated by the nuclear receptor RORγ represents an effective therapeutic opportunity in osteosarcoma.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rat monoclonal anti-RORg Thermo Fisher Scientific Cat#14-6988-82; RRID:AB_1834475 Rabbit monoclonal anti-GAPDH Cell Signaling Technology Ca#2118; RRID:AB_561053 Rabbit polyclonal anti-PARP Cell Signaling Technology Cat#9542; RRID:AB_2160739 Rabbit polyclonal anti-cleaved-Caspase-3 Cell Signaling Technology Cat#9661; RRID:AB_2341188 Rabbit monoclonal anti-AMPKa Cell Signaling Technology Cat#5832; RRID:AB_10624867 Rabbit monoclonal anti-p-AMPKa1 (Ser485) Cell Signaling Technology Cat#2537; RRID:AB_659805 Rabbit monoclonal anti-mTOR Cell Signaling Technology Cat#2983; RRID:AB_2105622 Rabbit monoclonal anti-p-mTOR(Ser2448) Cell Signaling Technology Cat#5536; RRID:AB_10691552 Rabbit monoclonal anti-Cystatin C Cell Signaling Technology Cat#24840; RRID:AB_2798885 Rabbit monoclonal anti-PGC-1b Abcam Cat#ab176328; RRID:AB_2893194 Mouse monoclonal anti-OXPHOS Abcam Cat#ab110411; RRID:AB_2756818 Goat polyclonal anti-GPX4 Abcam Cat#ab116703; RRID:AB_10898676 Rabbit polyclonal anti-4-HNE Abcam Cat#ab46545; RRID:AB_722490 Rabbit polyclonal anti-VDAC1 Abcam Cat#ab15895; RRID:AB_2214787 Rabbit monoclonal anti-ACC1 Beyotime Biotechnology Cat#AF1867; RRID:AB_3096398 Rabbit polyclonal anti-p-ACC(Ser79) Beyotime Biotechnology Cat#AA110; RRID:AB_3096395 Mouse monoclonal anti-Bcl-xL Santa Cruz Cat#sc-136207; RRID:AB_2064727 Rabbit polyclonal anti-SLC7A11 ABclonal Cat#A13685; RRID:AB_2760546 Anti-mouse IgG, HRP-linked Antibody Cell Signaling Technology Cat#7076; RRID:AB_330924 Anti-rat IgG, HRP-linked Antibody Cell Signaling Technology Cat#7077; RRID:AB_10694715 Anti-rabbit IgG, HRP-linked Antibody Cell Signaling Technology Cat#7074; RRID:AB_2099233 Bacterial and virus strains DH5a TSINGKE Cat#TSC-C14 Biological samples Osteosarcoma patient-derived xenografts (PDX) the First Affiliated Hospital, Sun Yat-sen University N/A Chemicals, peptides, and recombinant proteins Z-VAD-FMK TargetMol Cat#T7020 XY018 WuXi App Tec N/A GSK805 WuXi App Tec N/A Paclitaxel Selleck Cat#S1150 Antimycin A TargetMol Cat# T37497 Rotenone Selleck Cat#S2348 N-acetyl-L-cysteine Beyotime Biotechnology Cat#S0077 Methotrexate Acmec Biochemical Cat#M64330 IACS-010759 TargetMol Cat#T5337 Erastin, TargetMol Cat#T1765 Ferrostatin-1 TargetMol Cat#T6500 Critical commercial assays NAD+/NADH ratio Assay Kit Beyotime Biotechnology Cat#S0175 Lipid oxidation (MDA) Assay Kit Beyotime Biotechnology Cat#S0131S Cell-Titer GLO Promega Cat#G9241 Caspase GLO 3/7 Promega Cat#G8090 (Continued on next page) e1 Cell Reports Medicine 5, 101519, May 21, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Luciferase reporter gene Assay Kit Beyotime Biotechnology Cat#RG028 Reactive oxygen species Assay Kit Beyotime Biotechnology Cat#S0033S FerroOrange Assay Kit DOJINDO LABORATORIES Cat#F374 BODIPYTM 581/591 C11 (Lipid Peroxidation Sensor) Thermo Fisher Scientific Cat#D3861 Cell Mito Stress Test Kit Agilent Technologies Cat#103015-100 Glycolysis Stress Test Kit Agilent Technologies Cat#103020-100 Deposited data Raw and analyzed data Gene Expression Omnibus GEO: GSE99671, GSE39055, GSE126380, GSE28974, GSE33382 scRNA-seq data Gene Expression Omnibus GEO: GSE152048 and GSE162454 RNA-seq data This paper GSE261067 Western blot original images in this paper Mendeley Dataset https://doi.org/10.17632/yzygjpm6k5.1 Experimental models: Cell lines U2OS cell line ATCC HTB-96 MG63 cell line ATCC CRL-1427 143B cell line ATCC CRL-8303 SJSA-1 cell line ATCC CRL-2098 MNNG/HOS cell line ATCC CRL-1547 HEK293T cell line ATCC CRL-11268 143B-Luci cell line This paper N/A U2OS-MTX-R cell line This paper N/A hMSCs cell line Cyagen Biosciences HUXMA-01001 Experimental models: Organisms/strains Nude mice Nanjing Biomedical Research Institute of Nanjing University N/A NOD/SCID mice Nanjing Biomedical Research Institute of Nanjing University N/A Oligonucleotides siRNA targeting sequence This paper See Table S1 qRT-PCR Primer sequence This paper See Table S2 shRORg targeting sequence This paper GCCCTCATATTCCAACAACTT ChIP-PCR Primer sequence This paper See Table S3 Recombinant DNA Plasmids pBD-RORg-LBD This paper N/A Plasmids PBD-ERRa-LBD This paper N/A Plasmids PCMV-PPARg-LBD This paper N/A Plasmids pFR-luci This paper N/A Plasmids pcDNA-PGC-1b This paper N/A Plasmids PLX-304- RORg This paper N/A Software and algorithms ImageJ ImageJ https://imagej.nih.gov/ij/ GraphPad Prism7 GraphPad https://www.graphpad.com Flow Jo 7.6 Flow Jo https://www.flowjo.com R version 4.2.0 R Core Team 2017 https://www.r-project.org RStudio ( 2023.12.1–402) Posit.co https://posit.co/download/rstudio-desktop/ ggplot2 (v3.5.5) N/A https://ggplot2-book.org/ GSVA package v1.40.1 N/A http://www.sagebase.org Gene set enrichment analysis (GSEA) Broad Institute http://www.broad.mit.edu/gsea/ Cell Reports Medicine 5, 101519, May 21, 2024 e2 OPEN ACCESS OPEN ACCESS
|
TargetMol is a verified supplier 
TargetMol manufactures this product 